| Primary Identifier | MGI:5775777 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sh3d19 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Sh3d19-7698J-M1095 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGGACTAGCCATTGC, CCTGAATGTTTGGGCTCCCT, TCTTAGGCCTAACCACCGCT and AGCAACTGAACACTCGGAAC, which resulted in a 208 bp deletion spanning exon 3 beginning at Chromosome 3 positive strand position 86,098,069 bp, GGAGCCCAAACATTCAGGTC, and ending after CCAGTAAGTGATACCGAGCG at 86,098,276 bp (GRCm38/mm10). This mutation deletes exon 3 and 95 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a stop after residue 266. |
