| Primary Identifier | MGI:5775779 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Irgm2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Irgm2-7677J-F9554 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACAGGTTGGTTTCTGGG, TTCGTGTCCGATGAGCCTAA, CTTGGTAAAGGGTTTCGACG and CTCCCTGTCATCAAGTACCA, which resulted in a 442 bp deletion in exon 2 beginning at Chromosome 11 positive strand position 58,219,790 bp, CACCCAGAAACCAACCTGTT, and ending after TCAAGTACCACGGCCTCGTC at 58,220,231 bp (GRCm38/mm10). This mutation also has a 3 bp deletion (ggc) 49 bp before the 442 bp deletion. Together these are predicted to cause a change of amino acid sequence from RLI to II beginning at residue 83, due to the 3 bp deletion, followed by a change of amino acid sequence 15 residues later at amino acid 101 and early truncation 14 amino acids later. |
