|  Help  |  About  |  Contact Us

Allele : Irgm2<em1(IMPC)J> immunity-related GTPase family M member 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5775779 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Irgm2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Irgm2-7677J-F9554 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACAGGTTGGTTTCTGGG, TTCGTGTCCGATGAGCCTAA, CTTGGTAAAGGGTTTCGACG and CTCCCTGTCATCAAGTACCA, which resulted in a 442 bp deletion in exon 2 beginning at Chromosome 11 positive strand position 58,219,790 bp, CACCCAGAAACCAACCTGTT, and ending after TCAAGTACCACGGCCTCGTC at 58,220,231 bp (GRCm38/mm10). This mutation also has a 3 bp deletion (ggc) 49 bp before the 442 bp deletion. Together these are predicted to cause a change of amino acid sequence from RLI to II beginning at residue 83, due to the 3 bp deletion, followed by a change of amino acid sequence 15 residues later at amino acid 101 and early truncation 14 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Irgm2<em1J>,
  • Irgm2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele