|  Help  |  About  |  Contact Us

Allele : Muc3a<em1(IMPC)J> mucin 3A, cell surface associated; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5776697 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Muc3a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Muc3a-7685J-F6801 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCCCCTTCACCTTTGTG, CGGGTCCACTGACTGCCCCA, CAGAGCCTAGCTTTAGTGAA and TGCGAGGGCGGGCTTTTCCA, which resulted in a 398 bp deletion in exon 3 beginning at Chromosome 5 negative strand position 137,211,645 bp, CGACCTTGGAAAAGCCCGCC, and ending after AGGGTGGAGACGACTGCAAT at 137,211,248 bp (GRCm38/mm10). In addition there is a 2 bp intron insertion tc after the deletion which will not effect the mutation. This mutation deletes exon 3 and 235 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 40 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Muc3a<em1J>,
  • Muc3a<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories