| Primary Identifier | MGI:5776697 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Muc3a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Muc3a-7685J-F6801 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCCCCTTCACCTTTGTG, CGGGTCCACTGACTGCCCCA, CAGAGCCTAGCTTTAGTGAA and TGCGAGGGCGGGCTTTTCCA, which resulted in a 398 bp deletion in exon 3 beginning at Chromosome 5 negative strand position 137,211,645 bp, CGACCTTGGAAAAGCCCGCC, and ending after AGGGTGGAGACGACTGCAAT at 137,211,248 bp (GRCm38/mm10). In addition there is a 2 bp intron insertion tc after the deletion which will not effect the mutation. This mutation deletes exon 3 and 235 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 40 amino acids later. |
