| Primary Identifier | MGI:5775599 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp692 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp692-7728J-F4807 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGAATGGGAGGTCTGTA, TCCGCACTCACACACTTACA, GTCCTCTTCCCGAACCCAGT and TAAAAGACGTTAACAGGTAG, which resulted in a 190 bp deletion spanning exon 3 beginning at Chromosome 11 positive strand position 58307896 bp, GTTGGCCCTGTAAGTGTGTG, and ending after GGATCAGAAGCTCCTACTGG at 58308085 bp (GRCm38/mm10). This mutation deletes exon 3 and 158 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 35 amino acids later. |
