|  Help  |  About  |  Contact Us

Allele : Zfp692<em1(IMPC)J> zinc finger protein 692; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5775599 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp692
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zfp692-7728J-F4807 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGAATGGGAGGTCTGTA, TCCGCACTCACACACTTACA, GTCCTCTTCCCGAACCCAGT and TAAAAGACGTTAACAGGTAG, which resulted in a 190 bp deletion spanning exon 3 beginning at Chromosome 11 positive strand position 58307896 bp, GTTGGCCCTGTAAGTGTGTG, and ending after GGATCAGAAGCTCCTACTGG at 58308085 bp (GRCm38/mm10). This mutation deletes exon 3 and 158 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 35 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfp692<em1J>,
  • Zfp692<em1((MPC)J>,
  • Zfp692<em1((MPC)J>,
  • Zfp692<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele