| Primary Identifier | MGI:5775818 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Myo1d |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATTTGGTAATAAACTAAG, GAAACAGTTACTAGGACATT, TTTTAAATACCTTGCAGCTT and GCTGTGATTCCAAAGCTGCA into zygotes, which resulted in a 334 bp deletion at Chr 11: 80,692,846-80,693,179 bp (GRCm38/mm10). This deletion includes ENSMUSE00001265867. |
