|  Help  |  About  |  Contact Us

Allele : Myo1d<em1(IMPC)J> myosin ID; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5775818 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Myo1d
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATTTGGTAATAAACTAAG, GAAACAGTTACTAGGACATT, TTTTAAATACCTTGCAGCTT and GCTGTGATTCCAAAGCTGCA into zygotes, which resulted in a 334 bp deletion at Chr 11: 80,692,846-80,693,179 bp (GRCm38/mm10). This deletion includes ENSMUSE00001265867.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Myo1d<em1J>,
  • Myo1d<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories