|  Help  |  About  |  Contact Us

Allele : Smarcd3<em1(IMPC)J> SWI/SNF related BAF chromatin remodeling complex subunit D3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5775819 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Smarcd3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Smarcd3-7699J-M8045 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACGCCCTTTCACGCGGGG, GCGACCAAGTCATTCTAGCT, CCGCCCCTCTCCAAGACCCT and CCCACTCATCGCTCAGCGCA, which resulted in a 471 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 24,598,924 bp, CAGGGTTACCAACCCAGGGT, and ending after CAGCGACCAAGTCATTCTAG at 24,598,454 bp (GRCm38/mm10). This mutation deletes exon 2 and 259 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Smarcd3<em1J>,
  • Smarcd3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele