| Primary Identifier | MGI:7778443 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr431 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Nkx2-5 embryonic cardiac (anterior second heart field) enhancer, located upstream of the gene, was targeted using sgRNAs (equivalent to GATTACTTTATCTTCCCCGG and GGGACATCTTTTGTCTCT) with CRISPR/Cas9 technology, resulting in a 229 bp deletion (GRCm39:chr17:27069762-27069990). |
