|  Help  |  About  |  Contact Us

Allele : Rr431<em1Dasp> regulatory region 431; endonuclease-mediated mutation 1, David S Park

Primary Identifier  MGI:7778443 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr431
Is Recombinase  false Is Wild Type  false
molecularNote  The Nkx2-5 embryonic cardiac (anterior second heart field) enhancer, located upstream of the gene, was targeted using sgRNAs (equivalent to GATTACTTTATCTTCCCCGG and GGGACATCTTTTGTCTCT) with CRISPR/Cas9 technology, resulting in a 229 bp deletion (GRCm39:chr17:27069762-27069990).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Nkx2-5<deltaenh>,
  • Nkx2-5<deltaenh>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele