|  Help  |  About  |  Contact Us

Allele : Prpf4b<em1(IMPC)J> pre-mRNA processing factor 4B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5779705 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Prpf4b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Prpf4b-7776J-M6407 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTAGACAACTTTGAGCTT, CTTGTTCACTGCACCAAAAC, CCTGATTACCCAGCACTAGA and GTGTAAGCTCTTCTAGTGAC, which resulted in a 310 bp deletion across exon 5 beginning at Chromosome 13 positive strand position 34,889,350 bp, CTGTTTTGGTGCAGTGAACA, and ending after GTAGTGACAGTAACCAGTCA at 34,889,659 bp (GRCm38/mm10). This mutation deletes exon 5 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 522 and early truncation 42 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Prpf4b<->,
  • Prpf4b<->,
  • Prpf4b<em1J>,
  • Prpf4b<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories