|  Help  |  About  |  Contact Us

Allele : Telo2<em1(IMPC)J> telomere maintenance 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5781312 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Telo2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Telo2-7804J-9704M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCTCAGAAATGTGGCG, CCATGAGAGATGTCGAGGCA, AAGGCAACACTAGGCAGAGG and CAACACTAGGCAGAGGGGGG, which resulted in a 465 bp deletion around exon 3 beginning at Chromosome 17 negative strand position 25,113,380 bp, GGCTTATTTTACCACTGAGC, and ending after CTTCTCTTCTCAGAAATGTG at 25,112,916 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an insertion of two bp (AA) at the site of the mutation that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 112 and early truncation 55 amino acids later.
  • mutations:
  • Not Specified
  • synonyms:
  • Telo2<em1J>,
  • Telo2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories