| Primary Identifier | MGI:5781312 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Telo2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Telo2-7804J-9704M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTTCTCAGAAATGTGGCG, CCATGAGAGATGTCGAGGCA, AAGGCAACACTAGGCAGAGG and CAACACTAGGCAGAGGGGGG, which resulted in a 465 bp deletion around exon 3 beginning at Chromosome 17 negative strand position 25,113,380 bp, GGCTTATTTTACCACTGAGC, and ending after CTTCTCTTCTCAGAAATGTG at 25,112,916 bp (GRCm38/mm10). This mutation deletes exon 3 and 187 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an insertion of two bp (AA) at the site of the mutation that will not effect the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 112 and early truncation 55 amino acids later. |
