| Primary Identifier | MGI:5781315 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fam120a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fam120a-7754J-M691 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAAAAGATAGATAATGTC, GCTCTTCACTTGCACTCTCT, GGAGCAGTGTGTCACATGAT and AGTAGCTCTTTAAAGATGTC, which resulted in a 504 bp deletion around exon 2 beginning at Chromosome 13 negative strand position 48,949,451 bp, ATGATTGGTCCTGGCACTTT, and ending after TGGGCTCTTCACTTGCACTC at 48,948,948 bp (GRCm38/mm10). This mutation deletes exon 2 and 257 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 158 and early truncation 26 amino acids later. |
