|  Help  |  About  |  Contact Us

Allele : Kctd9<em1(IMPC)J> potassium channel tetramerisation domain containing 9; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5784897 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kctd9
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Kctd9-7773J-M6328 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGCGCTGAATCTCCTCAA, GCACAGAGTAATTGCCTATC, ACTAGTGACAGCCTTAGAAA and CAGCAGTGACACTACAGCAT, which resulted in a 277 bp deletion around exon 2 beginning at Chromosome 14 positive strand position 67,724,474 bp, CTCCTCAAGGGTCTCTTAAG, and ending after TGAGCTGTCTGTCACCTATG at 67,724,750 bp (GRCm38/mm10). This mutation deletes exon 2 and 155 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single base pair (C) deletion in the intron 42 bp before the 277 bp deletion that is not expected to alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 16 and early truncation 1 amino acid later.
  • mutations:
  • Not Specified
  • synonyms:
  • Kctd9<em1J>,
  • Kctd9<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories