|  Help  |  About  |  Contact Us

Allele : Cxcl2<em1(IMPC)J> C-X-C motif chemokine ligand 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5788425 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cxcl2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Cxcl2-7870J-M7781 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGTGCATAAAAGGAGCTCT, CGTGCATAAAAGGAGCTCTC, GGGGATCATTATAAGGCACG and TCTTTAGGGTGAGCATGGGG, which resulted in a 510 bp deletion beginning at Chromosome 5 positive strand position 90,903,835 bp, ATCGTGCATAAAAGGAGCTC, and ending after TGCCTTATAATGATCCCCAC at 90,904,344 bp (GRCm38/mm10). This mutation deletes exons 1 and 2 and 235 bp of flanking intronic sequence including the transcriptional start, splice acceptor and donor, and is predicted to create a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cxcl2<em1J>,
  • Cxcl2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

7 Publication categories