|  Help  |  About  |  Contact Us

Allele : Cdkn3<em1(IMPC)J> cyclin dependent kinase inhibitor 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5788504 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdkn3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Cdkn3-7867J-F7751 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATCATGGATCAGCTATG, ACTGCAAATATTAATTCAGT, TTTCCCCCCTCAATGTGTAA and TTTAATCCTTTACACATTGA, which resulted in a 353 bp deletion beginning at Chromosome 14 positive strand position 46,762,437 bp TAATTCAGTGGGTGTTTAAT, and ending after CTTTTAATCCTTTACACATTG at 46,762,789 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (A) inserted at the site of the deletion and a single bp deletion (A) 9 bp after the 353 bp deletion, which will not effect the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 20 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cdkn3<em1J>,
  • Cdkn3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories