| Primary Identifier | MGI:5788504 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdkn3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cdkn3-7867J-F7751 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTAATCATGGATCAGCTATG, ACTGCAAATATTAATTCAGT, TTTCCCCCCTCAATGTGTAA and TTTAATCCTTTACACATTGA, which resulted in a 353 bp deletion beginning at Chromosome 14 positive strand position 46,762,437 bp TAATTCAGTGGGTGTTTAAT, and ending after CTTTTAATCCTTTACACATTG at 46,762,789 bp (GRCm38/mm10). This mutation deletes exon 2 and 270 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp (A) inserted at the site of the deletion and a single bp deletion (A) 9 bp after the 353 bp deletion, which will not effect the results of that deletion. This mutation is predicted to cause a change of amino acid sequence after residue 3 and early truncation 20 amino acids later. |
