| Primary Identifier | MGI:5788505 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Jpt1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Hn1-7890J-M7394 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGAATCCGTGACTTTAACA, GGCGATCCTTGTTAAAGTCA, ATCGTAAACCCACTGATGGA and GCAGATGGATAAAGCACTGT, which resulted in a 500 bp deletion beginning at Chromosome 11 negative strand position 115,503,346 bp, TGTTGGTACCCTGACCCTCC, and ending after GCGATCCTTGTTAAAGTCAC at 115,502,847 bp (GRCm38/mm10). This mutation deletes exon 2 and 357 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 3 amino acids later. |
