| Primary Identifier | MGI:5788403 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdc37l1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Cdc37l1-7867J-M7730 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACCAGTGTGATACATGACA, GTATTGCCTCACAGAAAGAA, CATTATTTACCTTAAATGAG and CATTATTTACCTTAAATGAG, which resulted in a 273 bp deletion beginning at Chromosome 19 negative strand position 29,007,109 bp, ACATTCAAGGTTCATACAGT, and ending after ACATGACAGGGCAAGCCGAG at 29,006,837 bp (GRCm38/mm10). This mutation deletes exon 4 and 157 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 168 and early truncation 48 amino acids later. |
