| Primary Identifier | MGI:5788421 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kif15 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Kif15-7892J-M7412 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAGTAGGTCTAGTATT, AGTAACAGGTAAGTTTCCTG, CATTTGAAATATGTAATGTA and CAATTTGTCACTTTTTAGCT, which resulted in a 261 bp deletion beginning at Chromosome 9 positive strand position 122,959,773 bp, GAAACTTACCTGTTACTTTT, and ending after CTTTCATTTGAAATATGTAA at 122,960,033 bp (GRCm38/mm10). This mutation deletes exon 3 and 77 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 16 amino acids later. |
