| Primary Identifier | MGI:5788765 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pcyox1l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Pcyox1l-7923J-M8904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACGGTAAATCCAAGGGC, GCCCAGCCGGATGAGTGTGT, TCCTCTTCAAGGACCCCAGG and GCCTTCCTGATGCAAATGGC, which resulted in a 469 bp deletion beginning at Chromosome 18 negative strand position 61,702,507 bp AAAATAGACAGTTCCAGCCA, and ending after CAGAGCCCCACGTGTCATAC at 61,702,039 bp (GRCm38/mm10). This mutation deletes exon 3 and 294 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 13 amino acids later. |