|  Help  |  About  |  Contact Us

Allele : Pcyox1l<em1(IMPC)J> prenylcysteine oxidase 1 like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5788765 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pcyox1l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Pcyox1l-7923J-M8904 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGACGGTAAATCCAAGGGC, GCCCAGCCGGATGAGTGTGT, TCCTCTTCAAGGACCCCAGG and GCCTTCCTGATGCAAATGGC, which resulted in a 469 bp deletion beginning at Chromosome 18 negative strand position 61,702,507 bp AAAATAGACAGTTCCAGCCA, and ending after CAGAGCCCCACGTGTCATAC at 61,702,039 bp (GRCm38/mm10). This mutation deletes exon 3 and 294 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 99 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Pcyox1l<em1J>,
  • Pcyox1l<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories