| Primary Identifier | MGI:5789901 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Shisa7 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Shisa7-7952J-M6633 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GAAGAAATGTCCACAGCTGA, AGGATTGAGAGTGTCACATG, CTGTGGATGCCCTAAAGAAG and GCAGAGATGTGGTCCAGTTT, which resulted in a 399 bp deletion beginning at Chromosome 7 negative strand position 4,834,509 bp, CTGGACCACATCTCTGCACT, and ending after ATTCCAGTCTCCATCCATCA at 4,834,111 bp (GRCm38/mm10). This mutation deletes exon 3 and 244 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 227 and early truncation 32 amino acids later. |