|  Help  |  About  |  Contact Us

Allele : Mpped2<em1(IMPC)J> metallophosphoesterase domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5789904 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mpped2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Mpped2-7894J-M7436 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTATGATGACTATTACGA, CACCCAAACAGTCTAACGCA, AGACCGGGAAAGGTTAATTG and ATTTCTTGTATGATATGCTG, which resulted in a 356 bp deletion beginning at Chromosome 2 positive strand position 106,744,649bp CGAGGGTTCTGACATGTTTA, and ending after ATTTCTTGTATGATATGCTG at 106,745,004 bp (GRCm38/mm10). This mutation deletes exon 3 and 174 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 4 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Mpped2<em1J>,
  • Mpped2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories