| Primary Identifier | MGI:5789904 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mpped2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mpped2-7894J-M7436 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGTATGATGACTATTACGA, CACCCAAACAGTCTAACGCA, AGACCGGGAAAGGTTAATTG and ATTTCTTGTATGATATGCTG, which resulted in a 356 bp deletion beginning at Chromosome 2 positive strand position 106,744,649bp CGAGGGTTCTGACATGTTTA, and ending after ATTTCTTGTATGATATGCTG at 106,745,004 bp (GRCm38/mm10). This mutation deletes exon 3 and 174 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 43 and early truncation 4 amino acids later. |
