| Primary Identifier | MGI:5790709 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Serp2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Serp2-7951J-M6651 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCGAGGACAGCGGAGAACAC, CCTTAAACCTTAATCTTTAT, GTACGTGCTGAGGCTCCTAC and GACAGACTCTTGGATCCTAC, which resulted in a 222 bp deletion beginning at Chromosome 14 negative strand position 76,550,173 bp GATCCAAGAGTCTGTCACTC, and ending after TCACTGAATTATAGCCTGTG at 76,549,952 bp (GRCm38/mm10). This mutation deletes exon 2 and 149 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 28 and early truncation 8 amino acids later. |