| Primary Identifier | MGI:5792822 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rps6ka1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rps6ka1-7938J-F7135 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCAGGATCACAGAGCCCGTG, AAAGAACTGAGGCTGGGCTT, AGTGACTTAGATGATCCCTG and AGTGACTTAGATGATCCCTG, which resulted in a 308 bp deletion beginning at Chromosome 4 negative strand position 133,871,775 bp GTCCCCTTGATCTACTGAGG, and ending after GCTGCAGGATCACAGAGCCC at 133,871,468bp (GRCm38/mm10). This mutation deletes exon 4 and 226 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 16 amino acids later. There is an additional single bp (T) deleted 60 bp after the 303 bp deletion that is not expected to alter the results of the exon deletion. |
