|  Help  |  About  |  Contact Us

Allele : Smc1b<em1Jcs> structural maintenance of chromosomes 1B; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:5804171 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Smc1b
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAATATGTAGGCAAGAGTTTGAAC) and ssODN template (TTCTTAGTTTTTGAGGCCAGCAGAAAGGAAGCCAGAATATGTAGGCAAGAGTTGGAACAGGTGAAAAGACGGAGGTACGATGCTTTCAGTCAATGTTTTGAACACATCTCAGTCTCAATTGATCAA) with CRISPR/Cas9 technology, phenylalanine codon 1054 (TTT) was changed to leucine (TTG) (c.3162T>G, p.F1054L). This is the equivalent of the human p.F1055L mutation caused by SNP rs61735519.
  • mutations:
  • Single point mutation
  • synonyms:
  • Smc1b<F1055L>,
  • Smc1b<F1055L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele