|  Help  |  About  |  Contact Us

Allele : Tex15<em1Jcs> testis expressed gene 15 meiosis and synapsis associated; endonuclease-mediated mutation 1, John C Schimenti

Primary Identifier  MGI:5804172 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Tex15
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting AGTTTCCACGTATATTGACT) and ssODN template (AACTTACAGGCGTTAAAAGGCTTCTGAATAACTCTAAGTATTCAGTTTCCATATATATTGACTTGGTGCCACATACTGCATCTGTAAATTTTGGAAACACTGTGGCAGAATTAGAACATAACTACA) with CRISPR/Cas9 technology, threonine codon 2188 (ACG) was changed to isoleucine (ATA) (c.6563_6564delCGinsTA, p.T2188I). This is the equivalent of the human p.T2181I mutation caused by SNP rs61735519.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Tex15<T2181I>,
  • Tex15<T2181I>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories