| Primary Identifier | MGI:5804172 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tex15 |
| Strain of Origin | FVB/NJ x B6(Cg)-Tyr<c-2J>/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting AGTTTCCACGTATATTGACT) and ssODN template (AACTTACAGGCGTTAAAAGGCTTCTGAATAACTCTAAGTATTCAGTTTCCATATATATTGACTTGGTGCCACATACTGCATCTGTAAATTTTGGAAACACTGTGGCAGAATTAGAACATAACTACA) with CRISPR/Cas9 technology, threonine codon 2188 (ACG) was changed to isoleucine (ATA) (c.6563_6564delCGinsTA, p.T2188I). This is the equivalent of the human p.T2181I mutation caused by SNP rs61735519. |