| Primary Identifier | MGI:5795836 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab4b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Rab4b-7935J-M7105 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAGCCTGGGTTCCCAAGGAG, ATGCTGAGACTAGATTCTCC, AGACCATCCACCAAAGCTAG and GAATTGGGGTACAGAAAAGG, which resulted in a 435 bp deletion beginning at Chromosome 7 negative strand position 27,176,049 bp GCTTGCCTCTAGCTTTGGTG, and ending after TCAGCTCCTGGAGAATCTAG at 27,175,615 bp (GRCm38/mm10). This mutation deletes exon 3 and 320 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 2 amino acids later. |
