|  Help  |  About  |  Contact Us

Allele : Tnks1bp1<em1(IMPC)J> tankyrase 1 binding protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5795838 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tnks1bp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Tnks1bp1-7965J-M7446 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGACTTGCACCTAGAACGAT, AGGTTGGAGTGTGGAAGATT, ATTCAGGCAAACCCAGGCTA and ATAGCCCCTTTAAGACTTCA, which resulted in a 837 bp deletion beginning at Chromosome 2 positive strand position 85,051,847 bp ATTCGGTGCAGCAGGAGTCA, and ending after TTCAGGCAAACCCAGGCTAA at 85,052,683 bp (GRCm38/mm10). This mutation deletes exon 3 and 206 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is an 8 bp deletion (GAACGATG) 24 bp before the 837 bp del and an 8 bp insertion (GCTTCCTT) at the site of the 837 bp del, which will not alter the result of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 32 and early truncation 7 amino acids later.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Tnks1bp1<em1J>,
  • Tnks1bp1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories