|  Help  |  About  |  Contact Us

Allele : Adamtsl4<em1(IMPC)J> ADAMTS-like 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5795948 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Adamtsl4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Adamts14-8000J-M9624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGGCTTCACATTCCCACT, CTAGGTTATTAGACTAAGAG, AGGGACTGTGAACTGTTGGA and CGAGGGGTGGGGGACATCAG, which resulted in a 269 bp deletion beginning at Chromosome 3 negative strand position 95,685,133 bp GTTGGAAGGGGTCTGGCAAG, and ending after TGGCTTCACATTCCCACTGG at 95,684,865 bp (GRCm38/mm10). This mutation deletes exon 3 and 112 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 58 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Adamtsl4<em1J>,
  • Adamtsl4<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories