| Primary Identifier | MGI:5795948 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adamtsl4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Adamts14-8000J-M9624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGGCTTCACATTCCCACT, CTAGGTTATTAGACTAAGAG, AGGGACTGTGAACTGTTGGA and CGAGGGGTGGGGGACATCAG, which resulted in a 269 bp deletion beginning at Chromosome 3 negative strand position 95,685,133 bp GTTGGAAGGGGTCTGGCAAG, and ending after TGGCTTCACATTCCCACTGG at 95,684,865 bp (GRCm38/mm10). This mutation deletes exon 3 and 112 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 58 amino acids later. |
