| Primary Identifier | MGI:5803794 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Garre1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project 4931406P16Rik-7996J-M9596 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCACTTCTCAGGTAGCAGGG, AATAGAAGCCTAAACTCTGA, CGTATTAGTCACTCAGTAAC and GTTATCTCTGGGGGTCTCAC, which resulted in a 346 bp deletion beginning at Chromosome 7 negative strand position 34,254,222 bp, GGGGTCTCACTGGTCTCACTG, and ending after TGCACTTCTCAGGTAGCAG at 34,253,877 bp (GRCm38/mm10). This mutation deletes exon 8 and 248 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 418 and early truncation 63 amino acids later. |
