| Primary Identifier | MGI:5803796 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Abcd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Abcd3-7998J-F9901 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCATTCACTTTCTCTTGT, AACAACAATGCTTAACTACA, TTAACATTCTGCAATGCATT and CAGTAACTTGGTGAAGCTCT, which resulted in a 219 bp deletion beginning at Chromosome 3 negative strand position 121,791,897 bp, CAAGAGCTTCACCAAGTTAC, and ending after TAGTTTGCCTTGTAGTTAAG at 121,791,679 bp (GRCm38/mm10). This mutation deletes exon 4 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 27 amino acids later. |