|  Help  |  About  |  Contact Us

Allele : Abcd3<em1(IMPC)J> ATP-binding cassette, sub-family D member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5803796 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Abcd3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Abcd3-7998J-F9901 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCATTCACTTTCTCTTGT, AACAACAATGCTTAACTACA, TTAACATTCTGCAATGCATT and CAGTAACTTGGTGAAGCTCT, which resulted in a 219 bp deletion beginning at Chromosome 3 negative strand position 121,791,897 bp, CAAGAGCTTCACCAAGTTAC, and ending after TAGTTTGCCTTGTAGTTAAG at 121,791,679 bp (GRCm38/mm10). This mutation deletes exon 4 and 130 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 27 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Abcd3<em1J>,
  • Abcd3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele