|  Help  |  About  |  Contact Us

Allele : Cachd1<em1(IMPC)J> cache domain containing 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5795757 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cachd1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Cachd1-7843J-M9819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACATATAAACGACACCC, AAACACCTGGACATCATGGT, GCAAGTAATGAGAGATTCAC and ATCTCTATATTTAAACTTGT, which resulted in a 498 bp deletion beginning at Chromosome 4 positive strand position 100,897,481 bp CTACCATGATGTCCAGGTGT, and ending after CTTGTCGGCTTCTGCCCGTG at 100,897,978 bp (GRCm38/mm10). This mutation deletes exon 3 and 349 bp of flanking intronic sequence including the splice acceptor and donor, there is a single bp insertion T at this site, which will not effect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 101 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cachd1<em1J>,
  • Cachd1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories