| Primary Identifier | MGI:5795759 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tubb2a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Tubb2a-7712J-F7081 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTTGTCTGCATGCTGGT, CTGCTTTCTCTGTCACGGTA, CTGTCACCAGAAAGACAGCA and AGAGATTCTAAGCATGATGT, which resulted in a 170 bp deletion beginning at Chromosome 13 negative strand position 34,076,680 bp ATGTGGGATTGTCTTCATTT, and ending after GTCTCGCTTTCCATACCGTG at 34,076,511 bp (GRCm38/mm10). This mutation deletes exon 2 and 61 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 9 amino acids later. |
