| Primary Identifier | MGI:5803874 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fuca1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Fuca1-8333J-F7982 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGACTAGATACAGATTCTGA, GTAATACCTGTCCGTAAGAC, TTCAGAACCTGTAATTCATA and TCAACTACCTTATGAATTAC, which resulted in a 186 bp deletion beginning at Chromosome 4 positive strand position 135,929,843 bp, AGACTGGACTAGATACAGAT, and ending after GTGGTTATCAACTACCTTAT at 135,930,028 bp (GRCm38/mm10). This mutation deletes exon 4 and 80 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 206 and early truncation 3 amino acids later. |
