| Primary Identifier | MGI:5810098 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ankrd35 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Ankrd35-8102J-M2490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAGACCTAAAGGTGCTTAG, GGATAATTCTTGATGACACA, GAAGTTCGAACCACATACCA and AGTCAGTGTGGCTTGTGCGG, which resulted in a 383 bp deletion beginning at Chromosome 3 positive strand position 96,677,914 bp TGACACATGGAGTGGTTAGT, and ending after TTTGACCCCACCCTGGTATG at 96,678,296 bp (GRCm38/mm10). This mutation deletes exon 2 and 252 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 20 amino acids later. |
