| Primary Identifier | MGI:5806663 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap44 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Arhgap44-8008J-F4654 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGACCCTGACTGCAGAT, ACTTAGTACAAGCACACACA, GCGGGTGGAAGATTTTCAGT and ATAGTTTACTAATATAACTG, which resulted in a 88 bp deletion beginning at Chromosome 11 negative strand position 65,067,147 bp CCTCTGACGACTCTGGCGCA, and ending after TAAGGTGACCCCATGTGTG at 65,067,060 bp (GRCm38/mm10). This mutation deletes 68 bp of exon 4 and 20 bp of 3-prime flanking intronic sequence including the splice donor. The deletion of part of exon 4 but retention of the splice acceptor is predicted to lead to amino acid change after residue 69 and early truncation 3 amino acids later due to read through into intron 5. |
