|  Help  |  About  |  Contact Us

Allele : Arhgap44<em1(IMPC)J> Rho GTPase activating protein 44; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5806663 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap44
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arhgap44-8008J-F4654 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGACCCTGACTGCAGAT, ACTTAGTACAAGCACACACA, GCGGGTGGAAGATTTTCAGT and ATAGTTTACTAATATAACTG, which resulted in a 88 bp deletion beginning at Chromosome 11 negative strand position 65,067,147 bp CCTCTGACGACTCTGGCGCA, and ending after TAAGGTGACCCCATGTGTG at 65,067,060 bp (GRCm38/mm10). This mutation deletes 68 bp of exon 4 and 20 bp of 3-prime flanking intronic sequence including the splice donor. The deletion of part of exon 4 but retention of the splice acceptor is predicted to lead to amino acid change after residue 69 and early truncation 3 amino acids later due to read through into intron 5.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arhgap44<em1J>,
  • Arhgap44<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele