| Primary Identifier | MGI:5807187 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zc4h2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zc4h2-7995J-F9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATAACATAGTGTAGCAGAA, CCACTGACAGATCTAAGAAT, TTGAGAACTTGAACATAGAC and GATAATAGGACAGACTCCAG, which resulted in a 381 bp deletion beginning at Chromosome X negative strand position 95,643,567 bp CTGGAGTCTGTCCTATTATC, and ending after GTCAGAATACACGACCTATT at 95,643,187 bp (GRCm38/mm10). This mutation deletes exon 3 and 208 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 2 amino acids later. |