|  Help  |  About  |  Contact Us

Allele : Zfp711<em1(IMPC)J> zinc finger protein 711; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5807188 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp711
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Zfp711-8046J-F4983 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGATGTTGTCACAGATGA, CTGATGTTGTCACAGATGAT, AGATATCATTAAGTAGTCTT and TTCTACTGTTACCATAAAAA, which resulted in a 439 bp internal deletion beginning at Chromosome X positive strand position 112,614,979 bp, ACAGATGATGGGATAACTCT, and ending after TGTCAAGAGCACTTCTGAAG at 112,615,417 bp (GRCm38/mm10). This mutation deletes 439 bp from exon 3, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 1 amino acid later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Zfp711<em1J>,
  • Zfp711<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories