| Primary Identifier | MGI:5807188 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp711 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Zfp711-8046J-F4983 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGATGTTGTCACAGATGA, CTGATGTTGTCACAGATGAT, AGATATCATTAAGTAGTCTT and TTCTACTGTTACCATAAAAA, which resulted in a 439 bp internal deletion beginning at Chromosome X positive strand position 112,614,979 bp, ACAGATGATGGGATAACTCT, and ending after TGTCAAGAGCACTTCTGAAG at 112,615,417 bp (GRCm38/mm10). This mutation deletes 439 bp from exon 3, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 1 amino acid later. |
