|  Help  |  About  |  Contact Us

Allele : Actg2<em1(IMPC)J> actin, gamma 2, smooth muscle, enteric; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5807486 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Actg2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Actg2-8089J-M2448 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGATTGTGAAGAAAAACC, CAGGATTGTGAAGAAAAACC, ACCCCATATCCACTTCCCAT and ACAGATCTGCTGTGGTTGGG, which resulted in a 484 bp deletion beginning at Chromosome 6 negative strand position 83,523,034 bp CATGGGAAGTGGATATGGGG, and ending after GAGTTCCCAACAGAGAGTCC at 83,522,551 bp (GRCm38/mm10). This mutation deletes exon 5 and 399 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp deletion 40 bp before the start of the 484 bp deletion that will not alter the result of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 122 and early truncation 40 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Actg2<em1J>,
  • Actg2<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories