|  Help  |  About  |  Contact Us

Allele : Acy3<em1(IMPC)J> aminoacylase 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5810346 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Acy3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Acy3-8100J-M3948 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAAGTGAGACATACATG, GCTAACTTCTCACCTTTGGT, GTTTCCCCTCAAGAAGGCCT and GCCCTCCTTCCTGCCCCCTA, which resulted in a 437 bp deletion beginning at Chromosome 19 positive strand position 3,987,498 bp, ATGGGGAACAGGACCAACAT, and ending after TACCTACAGGTGGTCCCTAG at 3,987,934 bp (GRCm38/mm10). This mutation deletes exon 2 and 244 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 63 bp deletion 154 bp downstream of the 437 bp deletion. Overall this mutation is predicted to cause a change of amino acid sequence after residue 79 and early truncation 110 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Acy3<em1J>,
  • Acy3<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories