|  Help  |  About  |  Contact Us

Allele : Arv1<em1(IMPC)J> ARV1 homolog, fatty acid homeostasis modulator; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:5810348 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arv1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Arv1-8104J-M9010 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTAAAGAAGCCGTGAGCCG, GCTGCGGTAGGTATGCCTCT, TTAGTGGCTGAGCTGAGATA and GCATTACTAGTTGTCTCACC, which resulted in a 290 bp deletion beginning at Chromosome 8 positive strand position 124,728,265bp TCTTGGCATGCCCTCGGCTC and ending after AATCAAAGCTAAGACCTGGT at 124,728,554 bp (GRCm38/mm10). This mutation deletes exon 3 and 154 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is a 2 bp deletion in intron 4 after the 290 bp deletion that will not alter the effect of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 93 and early truncation 18 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Arv1<em1J>,
  • Arv1<em1J>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories