|  Help  |  About  |  Contact Us

Allele : Slc10a3<em1(IMPC)J> solute carrier family 10 (sodium/bile acid cotransporter family), member 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6383678 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc10a3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA, which resulted in a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655036 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor, donor and start of translation and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories