| Primary Identifier | MGI:6383678 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc10a3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCACTCCTTATAGTGCAG and GATGGCTGAATGACATTCAA, which resulted in a 2136 bp deletion beginning at Chromosome X position 74,368,986 bp and ending after 74,371,121 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000655036 (exon 3) and 341 bp of flanking intronic sequence including the splice acceptor, donor and start of translation and is predicted to generate a null allele. |
